Sequence ID | >WENV170962074 |
Genome ID | MRWF01004871 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 3972 |
End posion on genome | 4056 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
attctgttgt |
tRNA gene sequence |
GCGCGAGTGGCGGAACTGGTAGACGCGCTGGATTTAGGTTCCAGTGGGGCAACCCGTGAG |
Downstream region at tRNA end position |
cccctttctt |
Secondary structure (Cloverleaf model) | >WENV170962074 Leu TAG t ACCA cccctttctt G - C C - G G - C C - G G - C A - T G - C T G T C T C T C A C A A G | | | | | G T G G C G G A G A G C G | | | T T G A C G C T A G G TGGGGCAACCCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |