Sequence ID | >WENV170962095 |
Genome ID | MRWF01005866 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 122520 |
End posion on genome | 122446 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gggacactat |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
attcgaccga |
Secondary structure (Cloverleaf model) | >WENV170962095 Gly GCC t TCCA attcgaccga G - C C - G G - C G - C G - C C - G G - C T A T T A C C C A G A A + | | | | G G C T C G G T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |