Sequence ID | >WENV170962114 |
Genome ID | MRWF01006503 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 195126 |
End posion on genome | 195200 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cctcccggat |
tRNA gene sequence |
GCCGCCGTAGCTCAGGGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCCACAGTTCAATTC |
Downstream region at tRNA end position |
tttctcagat |
Secondary structure (Cloverleaf model) | >WENV170962114 Thr GGT t ACCA tttctcagat G - C C - G C - G G - C C - G C - G G - C T T T G T G T C A G A A | | | | | A G C T C G C A C A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |