Sequence ID | >WENV170962119 |
Genome ID | MRWF01006506 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 118067 |
End posion on genome | 117981 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cacgacacct |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTGTCCGTATGGACGTG |
Downstream region at tRNA end position |
tccccctgca |
Secondary structure (Cloverleaf model) | >WENV170962119 Leu CAG t ACCA tccccctgca G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGTCCGTATGGACGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |