Sequence ID | >WENV170962187 |
Genome ID | MRWF01008045 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 43789 |
End posion on genome | 43714 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tagctttcat |
tRNA gene sequence |
GCTGGCGTAGCTCAACTGGTAGAGCAGCGTCCTTGTAAGTCGAAGGTTGCAGGTTCGAGC |
Downstream region at tRNA end position |
ctatcaacag |
Secondary structure (Cloverleaf model) | >WENV170962187 Thr TGT t TCCA ctatcaacag G - C C - G T - A G - C G - C C - G G - C C G T T G T C C A C A A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A AGGTT G A C - G G - C T T C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |