Sequence ID | >WENV170962233 |
Genome ID | MRWF01009891 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 26158 |
End posion on genome | 26069 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cagtgcagag |
tRNA gene sequence |
GGAAGGGTGGCCGAGTGGTTTAAGGCACCGGTCTTGAAAACCGGCGTGGGTTCACGCCCA |
Downstream region at tRNA end position |
gcttcctcac |
Secondary structure (Cloverleaf model) | >WENV170962233 Ser TGA g GCCA gcttcctcac G - C G - C A - T A - T G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGGTTCACGCCCACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |