Sequence ID | >WENV170962270 |
Genome ID | MRWF01010668 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 10446 |
End posion on genome | 10531 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
catccgccac |
tRNA gene sequence |
GGTAGTGTGGCAGAGTGGCAATGCAGCGGTTTGCTAAACCGTACAGCCGAAAGGCTGCGG |
Downstream region at tRNA end position |
gattgaaagg |
Secondary structure (Cloverleaf model) | >WENV170962270 Ser GCT c GCCA gattgaaagg G - C G - C T - A A - T G - C T + G G - C C T T C T T C C A G A G | + | | | G T G A C G G G A G G C G | | | T T G A T G C C A A ACAGCCGAAAGGCTGC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |