Sequence ID | >WENV170962277 |
Genome ID | MRWF01010702 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 3715 |
End posion on genome | 3625 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gggagcggtc |
tRNA gene sequence |
GGAACGGTGCCCGAGTGGCTGAAGGGGCCGGATTGCTAATCCGGTGTACGGGGTAAACCC |
Downstream region at tRNA end position |
cacgcacgcc |
Secondary structure (Cloverleaf model) | >WENV170962277 Ser GCT c GCtt cacgcacgcc G - C G - C A - T A - T C - G G - C G - C T A T C T C C C A T G A G | | | | | G G G C C C G A G G G C G | | | T T C A G G G T G A G TGTACGGGGTAAACCCGTACC C - G C - G G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |