Sequence ID | >WENV170962279 |
Genome ID | MRWF01010860 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2466 |
End posion on genome | 2380 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tcctccgaat |
tRNA gene sequence |
GCTCCGGTGGTGAAATTGGTAGACACAAGAGACTTAAAATCTCTCGACCGTTAGGTCGTG |
Downstream region at tRNA end position |
tcttttttat |
Secondary structure (Cloverleaf model) | >WENV170962279 Leu TAA t ACCA tcttttttat G - C C - G T - A C - G C - G G - C G - C T T T C G G C C A T A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G A CGACCGTTAGGTCGT A - T G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |