Sequence ID | >WENV170962358 |
Genome ID | MRWF01013410 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 534 |
End posion on genome | 450 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attgctctat |
tRNA gene sequence |
GCCTTGGTGGCGGAACTGGTAGACGCGCTGGATTCAAAATCCAGTTCTTTCGGGAGTGTG |
Downstream region at tRNA end position |
aggcctttca |
Secondary structure (Cloverleaf model) | >WENV170962358 Leu CAA t ACAA aggcctttca G + T C - G C - G T - A T - A G - C G - C T T T C A C C C A C A A G | | | | | G T G G C G G T G G G C G | | | T T G A C G C T A G G TTCTTTCGGGAGT C - G T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |