Sequence ID | >WENV170962359 |
Genome ID | MRWF01013436 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 65036 |
End posion on genome | 65125 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gccccgatgc |
tRNA gene sequence |
GGAGAGTTGCCAGAGCGGTCGAATGGGGCGGTCTCGAAAACCGTTGTGCGTGCAAGCGTA |
Downstream region at tRNA end position |
ctttcttttg |
Secondary structure (Cloverleaf model) | >WENV170962359 Ser CGA c GCCA ctttcttttg G - C G - C A - T G - C A - T G - C T - A T A T C T C C C A C G A G | | | | | G G G A C C G A G G G C G | | | T T T A T G G C G A G TGTGCGTGCAAGCGTACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |