Sequence ID | >WENV170962377 |
Genome ID | MRWF01014096 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 36934 |
End posion on genome | 37023 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgggacttc |
tRNA gene sequence |
GGAGGAGTGGCAGAGTGGTTGAATGCGGCGGTCTTGAAAACCGTTGAGCCTTCGCGGGCT |
Downstream region at tRNA end position |
ctgccatcaa |
Secondary structure (Cloverleaf model) | >WENV170962377 Ser TGA c GCCA ctgccatcaa G - C G - C A - T G - C G - C A - T G - C T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C T G A G TGAGCCTTCGCGGGCTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |