Sequence ID | >WENV170962423 |
Genome ID | MRWF01015394 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2391 |
End posion on genome | 2304 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cggcagacaa |
tRNA gene sequence |
GCTCGAGTGGTGGAATTGGTAGACACGCCGGACTTAAAATCCTGTGGGCATTTTGCCCGT |
Downstream region at tRNA end position |
aagcccttat |
Secondary structure (Cloverleaf model) | >WENV170962423 Leu TAA a ACAA aagcccttat G + T C - G T - A C - G G - C A - T G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGGGCATTTTGCCCGT C - G C T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |