Sequence ID | >WENV170962437 |
Genome ID | MRWF01016056 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 136394 |
End posion on genome | 136320 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gggccgggac |
tRNA gene sequence |
GGGCGCGTAGCTCAGCGGGAGAGCACCTCGGTGACATCGAGGGGGTCGTAGGTTCAATCC |
Downstream region at tRNA end position |
tccaacccct |
Secondary structure (Cloverleaf model) | >WENV170962437 Val GAC c ACCA tccaacccct G - C G - C G - C C - G G - C C - G G - C C T T C A T C C A G A A | | | | | A C C T C G G T A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G G - C G T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |