Sequence ID | >WENV170962450 |
Genome ID | MRWF01016066 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 53918 |
End posion on genome | 54007 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agtccggaca |
tRNA gene sequence |
GGATGGGTGGCCGAGCGGTTGAAGGCACTGGTCTTGAAAACCAGCGTGCGTGAAAGCGTA |
Downstream region at tRNA end position |
ttccctagtt |
Secondary structure (Cloverleaf model) | >WENV170962450 Ser TGA a GCCA ttccctagtt G - C G - C A - T T - A G - C G - C G - C T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T G A A CGTGCGTGAAAGCGTACC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |