Sequence ID | >WENV170962478 |
Genome ID | MRWF01017363 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 25466 |
End posion on genome | 25552 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccttcacatt |
tRNA gene sequence |
GCCGGGATGGCGGAACTGGTAGACGCGCCGGACTCAAAATCCGGTTCTGGTGACAGAGTG |
Downstream region at tRNA end position |
gcttcctcaa |
Secondary structure (Cloverleaf model) | >WENV170962478 Leu CAA t ACCA gcttcctcaa G + T C - G C - G G - C G - C G - C A - T T T T C C C C C A C A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TTCTGGTGACAGAGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |