Sequence ID | >WENV170962532 |
Genome ID | MRWF01019419 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 292 |
End posion on genome | 380 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gatgccgcgc |
tRNA gene sequence |
GGAGGGATGGCAGAGCGGTAATGCAGCGGATTGCTAATCCGTCAACCGGTTAAACGGTTG |
Downstream region at tRNA end position |
cgacttaagc |
Secondary structure (Cloverleaf model) | >WENV170962532 Ser GCT c GCCA cgacttaagc G - C G - C A - T G - C G - C G - C A - T T G T C C C C C A G A G | | | | | G C G A C G G G G G G C G | | | T T G A T G C T A A CAACCGGTTAAACGGTTGC G + T C - G G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |