Sequence ID | >WENV170962599 |
Genome ID | MRWF01021309 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 576 |
End posion on genome | 662 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tatgctttgt |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTAATCGAAAGGTTGTG |
Downstream region at tRNA end position |
cttccctctt |
Secondary structure (Cloverleaf model) | >WENV170962599 Leu CAG t ACCA cttccctctt G - C C - G C - G C - G A - T G - C G - C T G T C C C T C A T A A G | | | | | A T G G C G G G G A G C G | | | T T G A C G C T A G G TAATCGAAAGGTTGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |