Sequence ID | >WENV170962640 |
Genome ID | MRWF01022513 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 417530 |
End posion on genome | 417605 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tgttttcact |
tRNA gene sequence |
GCCGGATTAGCTCAGTTGGTAGAGCACCCGCCTTGTAAGCGGTAGGTCGAGAGTTCGAGT |
Downstream region at tRNA end position |
attactgtct |
Secondary structure (Cloverleaf model) | >WENV170962640 Thr TGT t ACCA attactgtct G - C C - G C - G G - C G - C A - T T - A T G T C T C C C A T G A A | | | | G T C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC C T C - G C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |