Sequence ID | >WENV170962676 |
Genome ID | MRWF01023248 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 36057 |
End posion on genome | 36143 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aagggcccgt |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCTGGCTTCAGGTGCCAGTTGCCGCAAGGCAGTG |
Downstream region at tRNA end position |
tctttacccc |
Secondary structure (Cloverleaf model) | >WENV170962676 Leu CAG t ACCA tctttacccc G - C C - G C - G C - G A - T G - C G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TTGCCGCAAGGCAGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |