Sequence ID | >WENV170962680 |
Genome ID | MRWF01023356 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 573 |
End posion on genome | 489 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gaatcgatag |
tRNA gene sequence |
GCCCACGTGGTGGAATTGGTAGACACGCTACCTTGAGGGGGTAGTGTTCGTAAGGACGTG |
Downstream region at tRNA end position |
aaaaccgcaa |
Secondary structure (Cloverleaf model) | >WENV170962680 Leu GAG g ACac aaaaccgcaa G - C C - G C - G C - G A - T C - G G - C T C T T G A C C A T A A G + | | | | G T G G T G G C T G G C G | | | T T G A C A C T A G G TGTTCGTAAGGACGT C - G T - A A - T C - G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |