Sequence ID | >WENV170962699 |
Genome ID | MRWF01023992 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 944 |
End posion on genome | 860 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
catcggacac |
tRNA gene sequence |
GGAGGGGTGCCCGAGTGGCTAAAGGGGACGGACTGTAAATCCGTTGGCTATGCCTACGTT |
Downstream region at tRNA end position |
tccagcgcag |
Secondary structure (Cloverleaf model) | >WENV170962699 Tyr GTA c ACCA tccagcgcag G - C G - C A - T G - C G - C G - C G - C T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T C A G G G T A A G TGGCTATGCCTAC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |