Sequence ID | >WENV170962741 |
Genome ID | MRWF01025273 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 60091 |
End posion on genome | 60177 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctgcgccgaa |
tRNA gene sequence |
GCCAGAGTGGCGAAATTGGTAGACGCGACGGATTCAAAATCCGTTGGGGTAACACCCGTG |
Downstream region at tRNA end position |
gctttcccga |
Secondary structure (Cloverleaf model) | >WENV170962741 Leu CAA a ACCA gctttcccga G + T C - G C - G A - T G - C A - T G - C T G T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G G TGGGGTAACACCCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |