Sequence ID | >WENV170962777 |
Genome ID | MRWF01026618 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 395576 |
End posion on genome | 395503 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ccgatggcac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGAAGCTTCCCAAGCTTAAGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
atctccgaca |
Secondary structure (Cloverleaf model) | >WENV170962777 Gly CCC c TCCA atctccgaca G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A AGAC G A A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |