Sequence ID | >WENV170962784 |
Genome ID | MRWF01026626 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 128074 |
End posion on genome | 127990 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cttgattttt |
tRNA gene sequence |
GGAGGGGTACTCAAGCGGTCAACGAGGGCAGACTGTAAATCTGCTGGCTATGCCTTCGGA |
Downstream region at tRNA end position |
ggccaggtat |
Secondary structure (Cloverleaf model) | >WENV170962784 Tyr GTA t ACCA ggccaggtat G - C G - C A - T G - C G - C G - C G - C T A T C C T C C A C G A A | | | | | G G A C T C G G A G G C G | | | T T T C G A G C A A G TGGCTATGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |