Sequence ID | >WENV170962803 |
Genome ID | MRWF01027308 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 100576 |
End posion on genome | 100502 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gacgtggcct |
tRNA gene sequence |
GCTGCTGTAGCTCAGGGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGGAAGTTCAAATC |
Downstream region at tRNA end position |
cgcttcgttt |
Secondary structure (Cloverleaf model) | >WENV170962803 Thr GGT t ACCA cgcttcgttt G - C C - G T - A G - C C - G T - A G - C T A T T C T T C A G A A + | | | | A G C T C G G G A A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |