Sequence ID | >WENV170962809 |
Genome ID | MRWF01027316 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 32194 |
End posion on genome | 32103 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gcggacttgg |
tRNA gene sequence |
GGACAGGTGCGCGAGTGGCTGAAGCGGGCTCCCTGCTAAGGAGTTAGGCCCCCATAAGGG |
Downstream region at tRNA end position |
accttcgctc |
Secondary structure (Cloverleaf model) | >WENV170962809 Ser GCT g GCCA accttcgctc G - C G - C A - T C - G A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C G C G A G G G C G | | | T T C A G C G T G A G TAGGCCCCCATAAGGGCCTC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |