Sequence ID | >WENV170962811 |
Genome ID | MRWF01027322 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 255489 |
End posion on genome | 255564 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tttttgtttc |
tRNA gene sequence |
GGGTCGTTAGCTCAGCCGGTAGAGCACCGCACTTTTAATGCGATGGTCGTGCGTTCGAAT |
Downstream region at tRNA end position |
tctttcatct |
Secondary structure (Cloverleaf model) | >WENV170962811 Lys TTT c ACCA tctttcatct G - C G - C G - C T - A C - G G - C T - A T A T C A C G C A C G A A | | | | | G C C T C G G T G C G C G | | | | T T G G A G C T A A TGGTC C A C - G G - C C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |