Sequence ID | >WENV170962842 |
Genome ID | MRWF01028581 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 464436 |
End posion on genome | 464509 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caccacgaga |
tRNA gene sequence |
GGCGCGATGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACACCGGTTCGATTCC |
Downstream region at tRNA end position |
gaatttagct |
Secondary structure (Cloverleaf model) | >WENV170962842 Cys GCA a TCCA gaatttagct G - C G - C C - G G - C C - G G - C A - T T T T T G G C C A G A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |