Sequence ID | >WENV170962883 |
Genome ID | MRWF01029245 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1459 |
End posion on genome | 1543 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttcgcggcct |
tRNA gene sequence |
GCGCCAGTGGTGGAATTGGTAGACACGTCAGGTTTAGGTCCTGATGCCGCAAGGTGTGGG |
Downstream region at tRNA end position |
tccgacaata |
Secondary structure (Cloverleaf model) | >WENV170962883 Leu TAG t ACCA tccgacaata G - C C - G G - C C - G C - G A - T G - C T G T C T C C C A T A A G | + | | | A T G G T G G G G G G C G | | | T T G A C A C T A G G TGCCGCAAGGTGT T - A C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |