Sequence ID | >WENV170962914 |
Genome ID | MRWF01030596 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1036 |
End posion on genome | 947 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aggggcgtga |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTCGAAGGCGCACGCTTGGAAAGCGTGTAGGCGGGTAACCGTC |
Downstream region at tRNA end position |
ttggttccct |
Secondary structure (Cloverleaf model) | >WENV170962914 Ser GGA a GCCA ttggttccct G - C G - C A - T C - G A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCGGGTAACCGTCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |