Sequence ID | >WENV170962916 |
Genome ID | MRWF01030606 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 192475 |
End posion on genome | 192548 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cttctggagc |
tRNA gene sequence |
GGCTCTGTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
gtttcccctt |
Secondary structure (Cloverleaf model) | >WENV170962916 Cys GCA c TCCA gtttcccctt G - C G - C C - G T - A C - G T + G G - C T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |