Sequence ID | >WENV170962931 |
Genome ID | MRWF01030714 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 872 |
End posion on genome | 786 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcagttcttc |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGACCTTACGGTCGTG |
Downstream region at tRNA end position |
aaatcaggac |
Secondary structure (Cloverleaf model) | >WENV170962931 Leu GAG c ACCA aaatcaggac G - C C - G C - G G - C A - T A - T G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G G TGACCTTACGGTCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |