Sequence ID | >WENV170962967 |
Genome ID | MRWF01031727 |
Phylum/Class | [MRWF] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 5656 |
End posion on genome | 5740 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgccctatgg |
tRNA gene sequence |
GCCCCTGTGGCGGAATTGGTAGACGCGCGCGACTCAAAATCGCGTTCCGCAAGGAGTGCT |
Downstream region at tRNA end position |
tgttttccgc |
Secondary structure (Cloverleaf model) | >WENV170962967 Leu CAA g ACCA tgttttccgc G - C C - G C - G C - G C - G T - A G - C C T T C G G C C A T A A G | | + | | G T G G C G G C T G G C G | | | T T G A C G C T A G G TTCCGCAAGGAGT C - G G - C C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |