Sequence ID | >WENV170962997 |
Genome ID | MRWG01000001 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1146686 |
End posion on genome | 1146761 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cagtttcaaa |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
gtttcgagac |
Secondary structure (Cloverleaf model) | >WENV170962997 Gly GCC a TCCA gtttcgagac G - C C - G G - C G - C G - C A - T A - T T A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |