Sequence ID | >WENV170963030 |
Genome ID | MRWG01000004 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 457251 |
End posion on genome | 457325 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cgcctcacat |
tRNA gene sequence |
TCCGGCGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGTCGTAGGTTCGATCC |
Downstream region at tRNA end position |
gatttccagg |
Secondary structure (Cloverleaf model) | >WENV170963030 Asn GTT t GCCA gatttccagg T - A C - G C - G G - C G - C C - G G - C C T T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |