Sequence ID | >WENV170963046 |
Genome ID | MRWG01000005 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 446806 |
End posion on genome | 446890 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgaaggtagc |
tRNA gene sequence |
GCGGGCGTGGCGAAATTGGTAGACGCGCCAGATTTAGGTTCTGGTGTCTTCGGACGTGGG |
Downstream region at tRNA end position |
ccttcaggaa |
Secondary structure (Cloverleaf model) | >WENV170963046 Leu TAG c ACCA ccttcaggaa G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | A T A G C G G G G G G C G | | | T T G A C G C T A G G TGTCTTCGGACGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |