Sequence ID | >WENV170963067 |
Genome ID | MRWG01000007 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 373831 |
End posion on genome | 373905 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gccggtctgc |
tRNA gene sequence |
TCCCCGGTAGCTCAGTGGTAGAGCAACCGGCTGTTAACCGGTTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
gctttgctgc |
Secondary structure (Cloverleaf model) | >WENV170963067 Asn GTT c GCCA gctttgctgc T - A C - G C - G C - G C - G G - C G - C T A T C G G C C A G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |