Sequence ID | >WENV170963119 |
Genome ID | MRWG01000015 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 323696 |
End posion on genome | 323610 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgccggcctt |
tRNA gene sequence |
GCCCCAGTGGCGGAATCGGTAGACGCGACAGACTCAAAATCTGTTTCCGGCAACGGAGTG |
Downstream region at tRNA end position |
tcatcctcgc |
Secondary structure (Cloverleaf model) | >WENV170963119 Leu CAA t ACCA tcatcctcgc G - C C - G C - G C - G C - G A - T G - C T G T C G G G C A T A A G | | | | | G C G G C G G C C C G C G | | | T T G A C G C T A G G TTCCGGCAACGGAGT A - T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |