Sequence ID | >WENV170963137 |
Genome ID | MRWG01000018 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 308090 |
End posion on genome | 308016 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gtcaaaacat |
tRNA gene sequence |
GCCGCCGTAGCTCAGTGGTAGAGCGCGTCATTGGTAATGACGAGGTCCTCAGTTCAATCC |
Downstream region at tRNA end position |
gtttcctccc |
Secondary structure (Cloverleaf model) | >WENV170963137 Thr GGT t ACCA gtttcctccc G - C C - G C - G G - C C - G C - G G - C C T T G A G T C A G A A | | | | | A T C T C G C T C A G C G | | | | T T G G A G C T A G AGGTC C - G G - C T - A C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |