Sequence ID | >WENV170963164 |
Genome ID | MRWG01000024 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 371729 |
End posion on genome | 371654 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ctttggtgaa |
tRNA gene sequence |
GGGGCCATAGCTCAGTTGGGAGAGCGCGTGAATGGCATTCACGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
aaaccctaat |
Secondary structure (Cloverleaf model) | >WENV170963164 Ala GGC a ACCA aaaccctaat G - C G - C G + T G - C C - G C - G A - T C T T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G G - C T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |