Sequence ID | >WENV170963165 |
Genome ID | MRWG01000024 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 275723 |
End posion on genome | 275648 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cgggcttctc |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCAGCAATCGCACTGCTGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
tttccaagac |
Secondary structure (Cloverleaf model) | >WENV170963165 Ala CGC c ACCA tttccaagac G - C G - C G + T G - C C - G C - G G - C C T T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G A - T G - C C - G A - T A C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |