Sequence ID | >WENV170963219 |
Genome ID | MRWG01000045 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 514683 |
End posion on genome | 514757 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gatgcagcaa |
tRNA gene sequence |
GGGCGCGTAGCTCAGCGGGAGAGCACTGCCTTCACACGGCAGGGGTCGCTGGTTCAATCC |
Downstream region at tRNA end position |
ttcctttatg |
Secondary structure (Cloverleaf model) | >WENV170963219 Val CAC a ACCA ttcctttatg G - C G - C G - C C - G G - C C - G G - C C T T C G A C C A G A A | | | | | A C C T C G G C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A G - C C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |