Sequence ID | >WENV170963230 |
Genome ID | MRWG01000051 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 115790 |
End posion on genome | 115864 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcctcaccga |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAGCGGTTTTTGGTACCGTGTACCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tcggcctctc |
Secondary structure (Cloverleaf model) | >WENV170963230 Gln TTG a GCCA tcggcctctc T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTACC G + T C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |