Sequence ID | >WENV170963235 |
Genome ID | MRWG01000053 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 217619 |
End posion on genome | 217545 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gaggggctag |
tRNA gene sequence |
GCGGGCGTAGTTCAGTGGTAGAACGTCAGCTTCCCAAGCTGAATGTCGTCGGTTCGATCC |
Downstream region at tRNA end position |
tccccctccc |
Secondary structure (Cloverleaf model) | >WENV170963235 Gly CCC g TCCA tccccctccc G - C C - G G - C G - C G - C C - G G - C C T T T A G C C A G A A + | | | | G T C T T G G T C G G C G | | | | T T G G A A C T A G ATGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |