Sequence ID | >WENV170963237 |
Genome ID | MRWG01000057 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 106371 |
End posion on genome | 106457 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gggaaatgat |
tRNA gene sequence |
GCCAGCGTGGTGAAATTGGTAGACACGACGGATTCAAAATCCGTTGCCTTCACGGGCGTG |
Downstream region at tRNA end position |
tcttttccgt |
Secondary structure (Cloverleaf model) | >WENV170963237 Leu CAA t ACCA tcttttccgt G + T C - G C - G A - T G - C C - G G - C T G T C C G C C A T A A G | | | | | G T A G T G G G C G G C G | | | T T G A C A C T A G G TGCCTTCACGGGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |