Sequence ID | >WENV170963245 |
Genome ID | MRWG01000060 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 97542 |
End posion on genome | 97628 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gccccggtat |
tRNA gene sequence |
GCGGACGTGGCGGAACCGGTAGACGCAACAGACTTAAAATCTGTCGGGAGTAATCCCGTG |
Downstream region at tRNA end position |
ttccggcagc |
Secondary structure (Cloverleaf model) | >WENV170963245 Leu TAA t ACCA ttccggcagc G - C C - G G - C G - C A - T C - G G - C T G T C C C C C A C A A G | | | | | A C G G C G G G G G G C G | | | T T G A C G C T A G A CGGGAGTAATCCCGT A - T C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |