Sequence ID | >WENV170963295 |
Genome ID | MRWG01000083 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 187150 |
End posion on genome | 187224 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gctttacatg |
tRNA gene sequence |
GTGGTTGTAGCTCAGCTGGTTAGAGCGCTGGATTGTGGTTCCAGAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
aagtttaaaa |
Secondary structure (Cloverleaf model) | >WENV170963295 His GTG g CCtg aagtttaaaa G - C T - A G - C G - C T T T T G - C C A T T G G C C A C G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |