Sequence ID | >WENV170963297 |
Genome ID | MRWG01000085 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 523415 |
End posion on genome | 523501 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttaattattt |
tRNA gene sequence |
GCCGATGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGGAGTATTCCCGTG |
Downstream region at tRNA end position |
attcagattt |
Secondary structure (Cloverleaf model) | >WENV170963297 Leu GAG t ACCA attcagattt G - C C - G C - G G - C A - T T - A G - C T G T C C G C C A T A A G | | | | | G T G G T G G G C G G C G | | | T T G A C A C T A G G TGGGAGTATTCCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |