Sequence ID | >WENV170963337 |
Genome ID | MRWG01000111 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 235250 |
End posion on genome | 235340 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccactttac |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTATGGGTCAAAAGCCC |
Downstream region at tRNA end position |
ttttgatatt |
Secondary structure (Cloverleaf model) | >WENV170963337 Ser GCT c GCCA ttttgatatt G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C C G A G TATGGGTCAAAAGCCCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |